ID: 1083822979_1083822988

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1083822979 1083822988
Species Human (GRCh38) Human (GRCh38)
Location 11:65182963-65182985 11:65182992-65183014
Sequence CCCACGGTGAGAGGGGCCATCCT GACTCGGCTAAGCCAGATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 84} {0: 1, 1: 0, 2: 0, 3: 7, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!