ID: 1083827463_1083827469

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1083827463 1083827469
Species Human (GRCh38) Human (GRCh38)
Location 11:65211608-65211630 11:65211625-65211647
Sequence CCCCACTTCAGAGGCCACCCACT CCCACTCAGCACCACCGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 42, 4: 379} {0: 1, 1: 0, 2: 1, 3: 20, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!