ID: 1083827678_1083827686

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1083827678 1083827686
Species Human (GRCh38) Human (GRCh38)
Location 11:65212434-65212456 11:65212461-65212483
Sequence CCAGACACCTGCACTTACATAAG TCCAGGGCCTGCTGGGATCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 60, 4: 751}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!