ID: 1083854452_1083854460

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1083854452 1083854460
Species Human (GRCh38) Human (GRCh38)
Location 11:65385882-65385904 11:65385910-65385932
Sequence CCCCCTGGGGTTCACACCATTCT CTCAGCCTTCCCGCGTAGCTGGG
Strand - +
Off-target summary {0: 18, 1: 377, 2: 450, 3: 646, 4: 1212} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!