ID: 1083854453_1083854459

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1083854453 1083854459
Species Human (GRCh38) Human (GRCh38)
Location 11:65385883-65385905 11:65385909-65385931
Sequence CCCCTGGGGTTCACACCATTCTC CCTCAGCCTTCCCGCGTAGCTGG
Strand - +
Off-target summary {0: 44, 1: 679, 2: 10061, 3: 45622, 4: 51127} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!