ID: 1083854455_1083854459

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1083854455 1083854459
Species Human (GRCh38) Human (GRCh38)
Location 11:65385885-65385907 11:65385909-65385931
Sequence CCTGGGGTTCACACCATTCTCCT CCTCAGCCTTCCCGCGTAGCTGG
Strand - +
Off-target summary {0: 61, 1: 827, 2: 1004, 3: 1367, 4: 3276} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!