ID: 1083854458_1083854465

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1083854458 1083854465
Species Human (GRCh38) Human (GRCh38)
Location 11:65385909-65385931 11:65385937-65385959
Sequence CCTCAGCCTTCCCGCGTAGCTGG CAGGCGCCCGCCACCTCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 101, 2: 591, 3: 1476, 4: 1956} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!