ID: 1083859385_1083859403

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1083859385 1083859403
Species Human (GRCh38) Human (GRCh38)
Location 11:65411856-65411878 11:65411904-65411926
Sequence CCAGTTTCCCACCTTCCTCCTGC CTGGGCCACCACTCTGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 7, 3: 410, 4: 10797} {0: 2, 1: 0, 2: 0, 3: 25, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!