ID: 1083859389_1083859409

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1083859389 1083859409
Species Human (GRCh38) Human (GRCh38)
Location 11:65411867-65411889 11:65411913-65411935
Sequence CCTTCCTCCTGCTGGTGCTCCAT CACTCTGAGGAGGGTAGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 47, 4: 442} {0: 1, 1: 0, 2: 1, 3: 25, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!