ID: 1083863282_1083863285

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1083863282 1083863285
Species Human (GRCh38) Human (GRCh38)
Location 11:65438028-65438050 11:65438043-65438065
Sequence CCACTGGGAAGTTCTGTGTACCC GTGTACCCGGAATGTCGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 143} {0: 1, 1: 0, 2: 0, 3: 0, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!