|
Left Crispr |
Right Crispr |
| Crispr ID |
1083893554 |
1083893557 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:65608873-65608895
|
11:65608891-65608913
|
| Sequence |
CCCAAAGTGCTGGGATTACAGGC |
CAGGCCACTGCACCTGGCCGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 215700, 1: 270647, 2: 186590, 3: 142154, 4: 223611} |
{0: 1, 1: 1, 2: 14, 3: 128, 4: 1075} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|