ID: 1083896820_1083896821

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1083896820 1083896821
Species Human (GRCh38) Human (GRCh38)
Location 11:65624225-65624247 11:65624238-65624260
Sequence CCTGTCTACTTCTGCATCTGCTG GCATCTGCTGTCTGCTCATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 309} {0: 1, 1: 0, 2: 3, 3: 14, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!