ID: 1083899083_1083899093

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1083899083 1083899093
Species Human (GRCh38) Human (GRCh38)
Location 11:65635075-65635097 11:65635109-65635131
Sequence CCGCGTTGTGGCGCCTGGGGTTC AAGCTTCACCAGGTTGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 56} {0: 1, 1: 0, 2: 2, 3: 22, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!