ID: 1083899083_1083899097

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1083899083 1083899097
Species Human (GRCh38) Human (GRCh38)
Location 11:65635075-65635097 11:65635128-65635150
Sequence CCGCGTTGTGGCGCCTGGGGTTC AGGGGTGTGCCCAGCAGCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 56} {0: 1, 1: 0, 2: 3, 3: 13, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!