ID: 1083902651_1083902658

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1083902651 1083902658
Species Human (GRCh38) Human (GRCh38)
Location 11:65651064-65651086 11:65651099-65651121
Sequence CCAGGCCACTGCTTGGCTTCTCT ATTTGGTTCTGCAGGGAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 431} {0: 1, 1: 0, 2: 0, 3: 18, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!