ID: 1083903316_1083903322

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1083903316 1083903322
Species Human (GRCh38) Human (GRCh38)
Location 11:65654457-65654479 11:65654475-65654497
Sequence CCATTGGGGAGCCCCGGGGCCCC GCCCCCAGTGGAGCAGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 231} {0: 2, 1: 0, 2: 3, 3: 45, 4: 482}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!