ID: 1083919641_1083919649

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1083919641 1083919649
Species Human (GRCh38) Human (GRCh38)
Location 11:65775383-65775405 11:65775433-65775455
Sequence CCTTGCCACTGGAGTTCCGTGGA TGTCCTTTGAAGGATATGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 78} {0: 1, 1: 1, 2: 17, 3: 54, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!