|
Left Crispr |
Right Crispr |
| Crispr ID |
1083931092 |
1083931101 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:65845982-65846004
|
11:65846022-65846044
|
| Sequence |
CCAGCATAGGCTGGGCTCAGTGG |
AGTTCTATGGGAGGCCAAGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 26, 3: 164, 4: 872} |
{0: 2, 1: 47, 2: 3042, 3: 67285, 4: 160116} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|