ID: 1083933287_1083933301

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1083933287 1083933301
Species Human (GRCh38) Human (GRCh38)
Location 11:65857607-65857629 11:65857642-65857664
Sequence CCTGCCACCTGCTCCCGAGACGG AGGGAGGGTGACGCGCAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 128} {0: 1, 1: 0, 2: 2, 3: 5, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!