ID: 1083933287_1083933304

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1083933287 1083933304
Species Human (GRCh38) Human (GRCh38)
Location 11:65857607-65857629 11:65857657-65857679
Sequence CCTGCCACCTGCTCCCGAGACGG CAGACAGGAACAGCCTTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 128} {0: 1, 1: 0, 2: 2, 3: 34, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!