ID: 1083938624_1083938629

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1083938624 1083938629
Species Human (GRCh38) Human (GRCh38)
Location 11:65883262-65883284 11:65883278-65883300
Sequence CCAGCTTGTGGACCACTCTGTCC TCTGTCCTGCTGGTGGGTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 162} {0: 1, 1: 0, 2: 1, 3: 39, 4: 494}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!