ID: 1083938624_1083938636

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1083938624 1083938636
Species Human (GRCh38) Human (GRCh38)
Location 11:65883262-65883284 11:65883307-65883329
Sequence CCAGCTTGTGGACCACTCTGTCC CAAGTCAGAGGAGGGGATATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 162} {0: 1, 1: 0, 2: 0, 3: 15, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!