ID: 1083950639_1083950656

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1083950639 1083950656
Species Human (GRCh38) Human (GRCh38)
Location 11:65953713-65953735 11:65953760-65953782
Sequence CCCAGCGCAAGCTGGAGGAGCTG GGCCTGGTTGGGAGAGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 27, 4: 284} {0: 1, 1: 1, 2: 15, 3: 88, 4: 694}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!