ID: 1083966406_1083966418

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1083966406 1083966418
Species Human (GRCh38) Human (GRCh38)
Location 11:66046555-66046577 11:66046589-66046611
Sequence CCAGGAGAAGGTGAGCTTCCATC CAGGAGTAAGAGAGGGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 204} {0: 1, 1: 3, 2: 34, 3: 402, 4: 2075}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!