ID: 1083968002_1083968004

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1083968002 1083968004
Species Human (GRCh38) Human (GRCh38)
Location 11:66054677-66054699 11:66054701-66054723
Sequence CCTGTTTATGTAAGTCCTCTCAA TTCCATGTTCCTTCTGATCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 174} {0: 1, 1: 0, 2: 1, 3: 23, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!