ID: 1083992864_1083992883

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1083992864 1083992883
Species Human (GRCh38) Human (GRCh38)
Location 11:66257711-66257733 11:66257759-66257781
Sequence CCCCCTCCGACGCCACCGAGGTA GGGGCTGCTGGGAAGGCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52} {0: 1, 1: 0, 2: 9, 3: 75, 4: 1374}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!