ID: 1083992870_1083992881

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1083992870 1083992881
Species Human (GRCh38) Human (GRCh38)
Location 11:66257723-66257745 11:66257752-66257774
Sequence CCACCGAGGTAGCGGCTTCACCT CGGCGCGGGGGCTGCTGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 63} {0: 1, 1: 1, 2: 20, 3: 126, 4: 625}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!