ID: 1084000139_1084000150

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1084000139 1084000150
Species Human (GRCh38) Human (GRCh38)
Location 11:66291730-66291752 11:66291774-66291796
Sequence CCAGCGGGGGCTTCTCGGGGACG GGCGCTGCCGGCGGCGCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 78} {0: 1, 1: 2, 2: 6, 3: 67, 4: 789}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!