ID: 1084000201_1084000222

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1084000201 1084000222
Species Human (GRCh38) Human (GRCh38)
Location 11:66291949-66291971 11:66292001-66292023
Sequence CCCTCCGTGCTCCCCCCTATCAT CAGCCAGGACACCATGCCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 128} {0: 1, 1: 0, 2: 1, 3: 12, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!