ID: 1084003940_1084003941

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1084003940 1084003941
Species Human (GRCh38) Human (GRCh38)
Location 11:66313532-66313554 11:66313548-66313570
Sequence CCGAAGGGGGCGCTGGGCCACTC GCCACTCCTCCTCGCCTGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 108} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!