ID: 1084006825_1084006844

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1084006825 1084006844
Species Human (GRCh38) Human (GRCh38)
Location 11:66327377-66327399 11:66327420-66327442
Sequence CCAGCAACCCACATCTCCCACCA TGGGTGAGTGGTGGTGGGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 88, 4: 661}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!