ID: 1084021335_1084021355

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1084021335 1084021355
Species Human (GRCh38) Human (GRCh38)
Location 11:66420058-66420080 11:66420082-66420104
Sequence CCCCCGGCCCCGCCCCCGCCCCC GCCCGCGGGGAGACAGAGGCTGG
Strand - +
Off-target summary {0: 5, 1: 109, 2: 326, 3: 1478, 4: 8465} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!