ID: 1084021339_1084021353 |
View in Genome Browser |
Spacer: -6 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1084021339 | 1084021353 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 11:66420061-66420083 | 11:66420078-66420100 |
| Sequence | CCGGCCCCGCCCCCGCCCCCGGC | CCCGGCCCGCGGGGAGACAGAGG |
| Strand | - | + |
| Off-target summary | {0: 3, 1: 35, 2: 403, 3: 1403, 4: 5746} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||