ID: 1084030768_1084030782

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1084030768 1084030782
Species Human (GRCh38) Human (GRCh38)
Location 11:66479581-66479603 11:66479624-66479646
Sequence CCCTGGGCCCTCACCACTACTCC CGCATGCCCCACCCAGACCGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!