ID: 1084030793_1084030805

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1084030793 1084030805
Species Human (GRCh38) Human (GRCh38)
Location 11:66479661-66479683 11:66479701-66479723
Sequence CCAGACCTGTAAAAGTGGACCGC GGACTCCCTTTCGGGGCCGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!