ID: 1084044944_1084044949

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1084044944 1084044949
Species Human (GRCh38) Human (GRCh38)
Location 11:66563071-66563093 11:66563097-66563119
Sequence CCTGCCAAGCAGGCCGAGTACTG CCGCCGTATGGTGCCCTACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 82} {0: 1, 1: 0, 2: 0, 3: 1, 4: 16}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!