ID: 1084055185_1084055192

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1084055185 1084055192
Species Human (GRCh38) Human (GRCh38)
Location 11:66627397-66627419 11:66627435-66627457
Sequence CCAGGAAGACATGATAGCTAAAG AACCCAGGACTGGTGAGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 167} {0: 1, 1: 0, 2: 4, 3: 31, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!