ID: 1084067685_1084067696

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1084067685 1084067696
Species Human (GRCh38) Human (GRCh38)
Location 11:66714747-66714769 11:66714794-66714816
Sequence CCGGGAAGGAAGGGGGTGATCAG CTGGGGCATGAGGAGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 318} {0: 1, 1: 2, 2: 17, 3: 167, 4: 1300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!