ID: 1084074442_1084074454

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1084074442 1084074454
Species Human (GRCh38) Human (GRCh38)
Location 11:66762219-66762241 11:66762272-66762294
Sequence CCGCGAGGCCGCAGGGGGCCCGG TGAAGGGCGGGCGCACAGCCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 26, 4: 258} {0: 1, 1: 0, 2: 2, 3: 16, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!