ID: 1084074446_1084074449

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1084074446 1084074449
Species Human (GRCh38) Human (GRCh38)
Location 11:66762238-66762260 11:66762256-66762278
Sequence CCGGCCGCAGAACACGCGCGCAA CGCAAACTGAGCAGCCTGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 21} {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!