ID: 1084079956_1084079962

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1084079956 1084079962
Species Human (GRCh38) Human (GRCh38)
Location 11:66815866-66815888 11:66815901-66815923
Sequence CCTGTGAGTCATTATGATTTGCT ATAGAGAAACAGGTTCAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 143} {0: 1, 1: 1, 2: 6, 3: 46, 4: 421}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!