ID: 1084086290_1084086296

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1084086290 1084086296
Species Human (GRCh38) Human (GRCh38)
Location 11:66856854-66856876 11:66856869-66856891
Sequence CCTGTGCCAGGGTGAGTGCGCTG GTGCGCTGCGGCAGCGCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 169} {0: 1, 1: 0, 2: 1, 3: 28, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!