ID: 1084086290_1084086304

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1084086290 1084086304
Species Human (GRCh38) Human (GRCh38)
Location 11:66856854-66856876 11:66856904-66856926
Sequence CCTGTGCCAGGGTGAGTGCGCTG GCCCGCGCCGGCCCGGGCCTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 169} {0: 1, 1: 0, 2: 6, 3: 54, 4: 457}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!