ID: 1084093793_1084093795

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1084093793 1084093795
Species Human (GRCh38) Human (GRCh38)
Location 11:66896802-66896824 11:66896840-66896862
Sequence CCGCCTATATATACGCACATACA TATTTCTAGAATGACACTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 63, 4: 527} {0: 1, 1: 0, 2: 2, 3: 12, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!