ID: 1084110816_1084110822

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1084110816 1084110822
Species Human (GRCh38) Human (GRCh38)
Location 11:67013298-67013320 11:67013339-67013361
Sequence CCCTGGCCATGCAAGCTCTTGTG GCCTCCCTGCAGCTTCCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 273} {0: 1, 1: 0, 2: 4, 3: 38, 4: 396}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!