ID: 1084118716_1084118732

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1084118716 1084118732
Species Human (GRCh38) Human (GRCh38)
Location 11:67056721-67056743 11:67056761-67056783
Sequence CCTGGAGAGGAAGGGCCCCAGCC CACCTGGCTCTCGGGGCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 55, 4: 371} {0: 1, 1: 0, 2: 0, 3: 18, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!