ID: 1084121308_1084121316

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1084121308 1084121316
Species Human (GRCh38) Human (GRCh38)
Location 11:67070619-67070641 11:67070672-67070694
Sequence CCTCTCAGTGGCACCAGGTGTCC GTCGTCTTAGAGGCTGTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 176} {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!