ID: 1084146151_1084146159

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1084146151 1084146159
Species Human (GRCh38) Human (GRCh38)
Location 11:67266426-67266448 11:67266462-67266484
Sequence CCGGGGCGCGGGCGCGCGGGCGG GCCCCGACTGCAGTCCCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 109, 4: 612} {0: 1, 1: 0, 2: 0, 3: 10, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!