ID: 1084150409_1084150419

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1084150409 1084150419
Species Human (GRCh38) Human (GRCh38)
Location 11:67285568-67285590 11:67285584-67285606
Sequence CCTGGCCCAGCTCCCCCGGGAGG CGGGAGGGGCCCGCTTGCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 544} {0: 1, 1: 0, 2: 0, 3: 7, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!