ID: 1084154928_1084154934

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1084154928 1084154934
Species Human (GRCh38) Human (GRCh38)
Location 11:67308069-67308091 11:67308097-67308119
Sequence CCATCTAGATGGGATAGGGTGCT CAGAGGTCCCAGAGGGAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 54} {0: 1, 1: 0, 2: 7, 3: 68, 4: 554}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!